TK

 

Sign OutMy Account
 
Chat

 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
     

 |  |   

RNA Interference (RNAi)
RNA interference is a conserved pathway common to plants and mammals where double-stranded RNAs (dsRNAs) suppress expression of genes with complementary sequences1-2. RNAi was first observed in lower organisms, such as plants or nematodes. In these systems, long dsRNAs serve as effective triggers of RNAi. Long dsRNAs are not the actual triggers but are degraded by the endoribonuclease Dicer into small effector molecules called siRNAs (small interfering RNAs). SiRNAs are usually around 21 bases long with a central 19 bp duplex and 2-base 3'-overhangs. In mammals, Dicer processing occurs as a complex with the RNA-binding protein TRBP. The nascent siRNA associates with Dicer, TRBP, and Ago2 to form the RNA-Induced Silencing Complex, or RISC, which mediates gene silencing3. Once in RISC, one strand of the siRNA (the passenger strand) is degraded or discarded while the other strand (the guide strand) remains to direct sequence specificity of the silencing complex. The Ago2 component of RISC is a ribonuclease that cleaves a target RNA under direction of the guide strand. A schematic overview of the pathways involved in degradative RNAi is shown below.
Although long dsRNAs (several hundred bp) are commonly employed to trigger RNAi in C. elegans or D. melanogaster, these molecules will activate the innate immune system and trigger interferon (IFN) responses in higher organisms. RNAi can be performed in mammalian cells using short RNAs, which generally do not induce IFN responses. Many researchers today employ synthetic 21-mer RNA duplexes as their RNAi reagents, which mimic the natural siRNAs that result from Dicer processing of long substrate RNAs. An alternative approach is to use synthetic RNA duplexes that are greater than 21-mer in length, which are substrates for Dicer.
 
 
Developed as a collaborative effort between John Rossi (Beckman Research Institute of the City of Hope) and IDT, Dicer-substrate RNAs (DsiRNAs) are chemically synthesized RNA duplexes that have increased potency in RNA interference4. DsiRNAs are processed by Dicer into 21-mer siRNAs and designed so that cleavage results in a single, desired product. This is achieved through use of a novel asymmetric design where the RNA duplex has a single 2-base 3'-overhang on the AS strand and is blunt on the other end; the blunt end is modified with DNA bases. This design provides Dicer with a single favorable PAZ binding site that helps direct the cleavage reaction. Functional polarity is introduced by this processing event, which favors AS strand loading into RISC, and the increased potency of these reagents is thought to relate to linkage between Dicer processing and RISC loading5. The Dicer-substrate approach can result in reagents having as much as 10-fold higher potency than traditional 21-mer siRNAs at the same site. An example of the design of a DsiRNA is shown below.
 
ACGGCAAGCUGACCCUGAAGUUCAUCUGCACCACCGGCAATarget
 
  pACCCUGAAGUUCAUCUGCACCACcgDsiRNA
 ACUGGGACUUCAAGUAGACGUGGUGGC 
Dicer processing
 
  pACCCUGAAGUUCAUCUGCACCsiRNA
 ACUGGGACUUCAAGUAGACGUp 
 
 
While chemical modification of RNAi oligos is not required for siRNA function, certain modifications are sometimes useful. The antisense strand must have either a free 5'-OH or 5'-phosphate terminus6-7. A 5'-phosphate results in natural Dicer processing and this is the active form of the molecule. For 21-mer siRNAs, 5'-end modification of the sense strand RNA does not alter the efficacy of silencing and addition of a fluorescent dye, biotin, or other similar modifier can safely be done at this position. IDT recommends use of TYE™563 or Cy3™ when a fluorescent RNA is desired. Cellular autofluorescence in the spectrum of fluorescein limits its utility to track siRNAs in cell culture; TYE™563 and Cy3™ are brighter and spectrally does not suffer from the autofluorescence problem.
 
Chemical modification of DsiRNAs is slightly different due to the need to interact with Dicer. Modifications placed at the 3'-end of the sense strand have minimal impact on function or potency (IDT recommends this position for routine modification needs). Note that modifications placed at the 3'-S will be cleaved off the functional siRNA by Dicer processing; if a modification (such as biotin) is desired to be retained in the siRNA after cleavage, then 5'-S modification is preferred.
 
All RNAs have the potential to trigger IFN responses in cells8-9. Certain sequences and cell types are more at risk. Incorporation of 2'-O-methyl RNA residues can prevent activation of IFN responses10 and should be considered for all in vivo applications. IDT has developed modified DsiRNAs that evade immune detection and have improved nuclease stability in serum.
 

Use of siRNAs in vivo is showing great potential as both research tools and as therapeutic agents11. DsiRNAs have been successfully used in vivo12 and are available from milligram to gram scale both as chemically stabilized and as unmodified RNA. Large-scale sterile, endotoxin-free preparations are available specifically for in vivo research needs.
 

Please contact Customer Care at 800-328-2661 to discuss your specific.
 
DsiRNA catalog page
TriFECTa™ catalog page
DsiRNA RefSeq Library interface tool
DsiRNA Design tool (scitools)

1. Unlocking the potential of the human genome with RNA interference. Hannon, G.J. and Rossi, J.J. Nature, 431, 371-378 (2004)

2. Mechanisms of gene silencing by double-stranded RNA. Meister, G. and Tuschl, T. Nature, 431, 343-349 (2004).

3. TRBP recruits the Dicer complex to Ago2 for microRNA processing and gene silencing. Chendrimada, T.P., Gregory, R.I., Kumaraswamy, E., Norman, J., Cooch, N., Nishikura, K. and Shiekhattar, R. Nature, 436, 740-744 (2005).

4. Synthetic dsRNA Dicer substrates enhance RNAi potency and efficacy. Kim, D.H., Behlke, M.A., Rose, S.D., Chang, M.S., Choi, S. and Rossi, J.J. Nat Biotechnol, 23, 222-226 (2005).

5. Functional polarity is introduced by Dicer processing of short substrate RNAs. Rose, S.D., Kim, D.H., Amarzguioui, M., Heidel, J.D., Collingwood, M.A., Davis, M.E., Rossi, J.J. and Behlke, M.A. Nucleic Acids Res, 33, 4140-4156 (2005).

6. siRNA function in RNAi: a chemical modification analysis. Chiu, Y.L. and Rana, T.M. RNA, 9, 1034-1048 (2003).

7. Sequence, chemical, and structural variation of small interfering RNAs and short hairpin RNAs and the effect on mammalian gene silencing. Harborth, J., Elbashir, S.M., Vandenburgh, K., Manninga, H., Scaringe, S.A., Weber, K. and Tuschl, T. Antisense Nucleic Acid Drug Dev, 13, 83-105 (2003).

8. Activation of the mammalian immune system by siRNAs. Marques, J.T. and Williams, B.R. Nat Biotechnol, 23, 1399-1405 (2005).

9. A structural basis for discriminating between self and nonself double-stranded RNAs in mammalian cells. Marques, J.T., Devosse, T., Wang, D., Zamanian-Daryoush, M., Serbinowski, P., Hartmann, R., Fujita, T., Behlke, M.A. and Williams, B.R. Nat Biotechnol, 24, 559-565 (2006).

10. Design of noninflammatory synthetic siRNA mediating potent gene silencing in vivo. Judge, A.D., Bola, G., Lee, A.C. and MacLachlan, I. Mol Ther, 13, 494-505 (2006).

11. Progress towards in vivo use of siRNAs. Behlke, M.A. Mol Ther, 13, 644-670 (2006).

12. Rational design and in vitro and in vivo delivery of Dicer substrate siRNA. Amarzguioui, M., Lundberg, P., Cantin, E., Hagstrom, J.E., Behlke, M.A. and Rossi, J.J. Nature Protocols, 1, 508-517 (2006).



 
 
© Copyright 2010 Integrated DNA Technologies, Inc

800-328-2661 ◊ +1-319-626-8400 ◊ custcare@idtdna.com
For problems or questions about the IDT website, please email: webmaster@idtdna.com