Sign InMy Account United States Canada Australia United Kingdom Israel Japan Belgium Taiwan South Korea Chile Italy Other United States

0 Items $0.00       Loading Cart ...

 

General Information

About Us

What We Do

Careers

News & Events

E-Commerce Solutions

Trade Your Synthesizer for Oligos

 

How to Order

How to Contact

Shipping Information

Email/Fax ordering

Privacy & Security

Usage, Warranty and Licenses

 

DNA/RNA Synthesis

Modifications

Purifications

Gene Expression

Genotyping

Gene Silencing

NextGen Sequencing

Synthetic Genes

miRNA

Molecular Biology Reagents

OligoCards & Miscellaneous

H1N1

View All Products

 

SameDay Oligo Service

Custom DNA Oligos

Custom RNA Oligos

ReadyMade Products

Ultramer Oligos

96 and 384 Well Plates

HOTPlates

Custom Oligos for Arrays

 

ReadyMade Primers

ReadyMade Randomers

Aminoacyl-Adenylate Analogs

 

Phosphorylation

Attachment Chemistry / Linkers

Fluorophores

Iowa Black Dark Quenchers

Dark Quenchers

Spacers

Modified Bases

Phosphorothioate Bonds

 

Rapid HPLC Service

PAGE and HPLC Purification

 

PrimeTime qPCR Assays

PrimeTime qPCR Probes

Molecular Beacons

Dual Labeled Probes

Express PrimeTime Probes

RealTime PCR Assay Design Tool

PrimerQuest PCR Design Tool

 

LNA PrimeTime Probes

 

Pre-designed DsiRNA

Custom DsiRNA

DsiRNA Controls and Reagents

TriFecta RNAi Kit

TriFECTin Transfection Reagent

Transductin Delivery Reagent

DNA-Directed RNAi (ddRNAi)

ddRNAi Design Tool

RNAi Duplex Oligos

RNAi Design

Antisense Oligonucleotides

Antisense Design Tool

 

Primers for 454 Sequencing System

FusionPrimers Design Tool

Rapid Library Adaptors

 

Gene Synthesis

Custom Vector Request

 

StarFire miRNA Detection Kit

miRNA Cloning Products

mirCat Small RNA Cloning Kit

 

Oligo Length Standards

Buffers and Solutions

Nuclease Detection Products

 

OligoCards

TShirts

 

Main Menu

View Cart

Order History

WishList

My Account

OligoCard

LabLinker

Delete All Items

CheckOut

 

View Your Groups

Create New Group

 

Contact

FAQs

IDT Publications

Technical & Educational Material

International

 

Analytics

OEM

cGMP Manufacturing

Custom Labels

Packaging and Formulation

 

Preparative & Analytical Service

Mass Spectromentry and CE

 

OligoAnalyzer

RealTime PCR

mFold

RNAi

AntiSense Design

PrimerQuest

FusionPrimers Design

Dilution Calculator

Resuspension Calculator

miRNA Detection Kits

 

RNAi Design

Predesigned DsiRNA

ddRNAi Design

 

Home

Products

Order

Support

Services

SciTools

|

|

Favorites 
Digg 
Twitter 
del.icio.us 
Technorati 
FaceBook 
Reddit 
Yahoo 
Google 

---

Follow us on Twitter

Primers for 454 Sequencing System    Documentation and Support Frequently Asked Questions

In an exclusive agreement with 454 Life Sciences, a Roche Company, IDT is able to provide researchers with 454 Fusion Primer design software and custom primers for the Genome Sequencer FLX System.     454 Fusion Primers are required for a number of 454 Sequencing applications. These applications include "ultra-deep", amplicon sequencing for detection of low-frequency mutations, and the comprehensive identification and quantification of common and rare sequences within a population. These studies are easily initiated with 454 Fusion Primer design software to target individual exons or all exons from one or more genes.     Roche recommends IDT’s HPLC-purified 454 Fusion Primers as the best way for a researchers to ensure they are getting the best data from their sequencing runs. The high purity level of HPLC-purified primers minimizes the risk of mis-priming events due to truncations and other errors that may compromise sequencing data quality or the number of viable reads that can be obtained from a single PicoTiterPlate run. As with all IDT oligos, identity is guaranteed with 100% Mass Spec QC.     Visit the 454 Life Sciences website for more information on the Genome Sequencer FLX System

OrderingProductsSupport Order Using IDT's 454 GS FLX System Primer Design Tool Order from 454 GS FLX System Extended MID Rapid Library Set GS FLX Standard Fusion Primers The Fusion Primer design tool will incorporate specific indentifying sequences into your gene-specific primers.   GS FLX Titanium Fusion Primers Design and order GS FLX Titanium Fusion Primers which will allow for longer and improved sequencing runs. GS FLX Titanium Rapid Library Adaptors with Extended MID List Access all available Molecular Identifier (MID) tags available. MIDs will allow identifying tags to be placed on multiple libraries so that they may be multiplexed for sequencing. GS FLX Standard Fusion Primers Fusion Primers consist of a 20-25 bp target-specific sequence (3’ end) and a 19 bp fixed sequence (Primer A or Primer B on the 5’ end). Amplicon sequencing projects use 454 Fusion Primers to incorporate specific identifying sequences into your gene-specific primers. This allows the process to proceed directly into emPCR for sequencing and is often associated with Ultra-Deep sequencing applications. The software enables an investigator to initiate the survey of one or more gene locus. 454 FusionPrimers are optimized across all functionality in the workflow, not just the initial PCR. Users can create sequencing primers for large surveys as well as specific focused projects. GS FLX Titanium System Fusion Primers GS FLX Titanium Fusion Primers have a 25 bp fixed sequence (Primer A or Primer B on the 5’ end) and optional Multiplex Identifier (MID) sequence. This design will allow: Longer amplicons to be sequenced An increase in the number of reads per run An improvement in read representation for bidirectional sequencing More simplified choices for reagent kits and protocols Titanium Fusion Primers can also be used to sequence existing amplicon libraries that were created using the Standard Fusion Primers. Roche highly recommends transitioning amplicon library designs to the new format to achieve optimal performance. GS FLX Titanium Rapid Library MID Adaptor Oligos Titanium Rapid Library MID Oligos are intended for shotgun sequencing; the MIDs are included in order to multiplex different samples on a single sequencing run. GS FLX Titanium Rapid Library MID Adaptors Extended List The GS FLX Titanium Rapid Library MID Adaptors Extended List includes a set of Adaptors that can be substituted for the Adaptors of the GS FLX Titanium Rapid Library Preparation Kit for the preparation of DNA libraries for sequencing on the Genome Sequencer FLX System. Tagging multiple libraries with different MIDs allows them to be amplified and sequenced together in a single region of the PicoTiterPlate device. For customers that need more MIDs than the twelve supplied by 454 in the GS FLX Titanium Rapid Library MID Adaptors Kit, this Extended List provides additional sequences that have been optimized for MID applications. Each MID sequence contains at least 4 changes (insertion, deletion, or substitution) to make it unique from the other members of the Extended MID Set. This means that, for any of these MIDs, it is possible to either detect up to 2 errors and correct 1 error, or alternatively, detect 3 errors and correct none. The Extended Set MIDs are sorted according to the number of reagent flows needed to sequence each, with a lower number indicating fewer flows. As a result, the lower numbered entries of the Extended Set MIDs are preferable to the higher numbered Adaptors because they can be sequenced using fewer reagent flows thereby maximizing the number of remaining flows for sequencing the library fragment. Technical Information GS FLX System Workflow Overview of Amplicon Sequencing Overview of Multiplexing Application for GS FLX Titanium Rapid Library MID Adaptors

GS FLX System Workflow Generate single-stranded template DNA library Short adaptors that are specific to the 3’ and 5’ ends are added to each fragment for the purification, amplification, and sequencing steps. The single-stranded DNA library is then immobilized on DNA Capture Beads and emulsified. The result in one bead per unique fragment. Amplify the library with emulsion PCR (emPCR) Each unique fragment is amplified individually but simultaneously with the other fragments in the library. The result will be several million copies of each unique fragment. Sequence to generate data The Genome Sequences FLX Instrument uses a flow of individual nucleotides in a fixed order to sequence the hundreds of thousands of wells that each contain one bead. 4. Analyze data with bioinformatics tools For more information on this process, please see the Roche information on How it Works

Overview of Amplicon Sequencing The Genome Sequence System is able to sequence single molecules within a mixture of molecules. Each amplicon molecule is sequenced individually which allows for rare variants to be identified and haplotype information to be assigned. This method relies on emulsion PCR (emPCR) with special Fusion Primers which attach specific 3’ and 5’ adaptors (sequence A and B) to each end of the fragments. The primers have a target-specific region and a fixed region which serves as a priming site during the clonal amplification and allows the fragment to bind to the DNA Capture Beads. In addition, the fixed sequences act as the primers site during the sequencing reaction. Primer A: Left template-specific primer Fusion Primer A: GCCTCCCTCGCGCCATCAGTCTGACGATCTCTGTCTTCTAACC Primer B: Right template-specific primer Fusion Primer B: GCCTTGCCAGCCCGCTCAGGCCTTGAACTACACGTGGCT

Overview of Multiplexing Through the use of unique Multiplex Identifier (MID) Adaptors for each individual library, the libraries can be amplified by emPCR and sequenced together in one multiplex reaction. Once the sequencing reads are complete, the data analysis software can deconvolute the data so that each individual library can be identified by its MID tag.

Application for GS FLX Titanium Rapid Library MID Adaptors The GS FLX Titanium Rapid Library MID Adaptors can be substituted for the Adaptor of the GS FLX Titanium Rapid Library Preparation Kit during the creation of a library from a DNA sample (e.g., genomics DNA from an organism of interest). The library consists of a set of single-stranded template DNA fragments representing the entire span of the sample sequence. Each fragment is flanked by suitable amplification and sequencing DNA adaptors (MID adaptors in this case), then purified and quantitated. MIDs become part of the sequence of each read in the library, such that they provide a recognizable sequence tag at the beginning of each read. When multiple libraries are prepared with different MIDs, they can be sequenced together, in a single region of the PTP device; the data analysis software then deconvolutes the data and assigns each read to the correct library. Multiplex sequencing can greatly improve the utilization of available wells on the PTP device during a sequencing run. This technique can be especially useful for sequencing many small samples in parallel, such as samples from viruses, BACs, plasmids, small bacterial genomes, disease-associated regions, etc.