You will be logged off in   seconds due to inactivity. Click here to continue using this web page.

Gene Entry

Paste Entry

The vector applied to each sequence is dependent on each sequence's length.

Sequence LengthpIDTBlueIDT Vector (Amp)IDT Vector (Kan)BAC
< 1501 bp
1501 - 5000 bp
> 5000 bp
Instructions:
Enter sequence information in the following order: Name, Sequence, Notes
Please enter one sequence per line as indicated in the examples below.
Do not enter synthesis instructions or modifications in the notes field.

Examples:
  1. Sequence 1,ATTAACACCGAAGGTCGTGCAACCGAAGATTAAGATAATGCATAAACCGAATGTCAC,PCR control
  2. Sequence 2,TAATAGCCTGCAAGCACGGAATGAGGCGAAAATGAATAAGAGAACACCCGTTATTAG,G to A mutant
Format:
# of Lines
 
 
-

-


Design and Analysis Tools
-

-


Related Products
-

-