You will be logged off in   seconds due to inactivity. Click here to continue using this web page.

gBlock Entry

Paste Entry
Instructions:

Enter sequence information in the following order: Name, Sequence, Notes
Please enter one sequence per line as indicated in the examples below.
Do not enter synthesis instructions or modifications in the notes field.

Examples:

  1. Sequence 1,ATTAACACCGAAGGTCGTGCAACCGAAGATTAAGATAATGCATAAACCGAATGTCAC,PCR control
  2. Sequence 2,TAATAGCCTGCAAGCACGGAATGAGGCGAAAATGAATAAGAGAACACCCGTTATTAG,G to A mutant

Choose Modification Type:


Format:
# of Lines
-

-


Design and Analysis Tools
-

-


Related Products
-

-