Genome Editing
Support and Educational Content

Genome editing in C. elegans using the Alt-R® CRISPR System


Improved editing with Alt-R CRISPR crRNA:tracrRNA and Cas9 RNP approach

The Dernburg Laboratory (University of California, Berkeley, CA, USA) has been experimenting with CRISPR technology for genome editing in the nematode, Caenorhabditis elegans. They have found that injection of Cas9 protein complexed with the Alt-R® CRISPR tracrRNA:crRNA oligos from IDT provides a robust method for introducing mutations and insertions into C. elegans, far surpassing the editing efficiencies they have obtained with plasmid delivery of Cas9 and sgRNA. They report that the synthetic RNA oligonucleotide approach eliminates time, labor, and variability associated with in vitro transcription of sgRNAs at a very reasonable cost. The researchers chose to use the Alt-R CRISPR System as scientists at IDT have done extensive in-house optimization of CRISPR RNA structure, chemical modifications, length, and delivery.

With plasmid-based delivery of Cas9 and sgRNA, the Dernburg Lab typically detect their desired insertion in only ~1% of red fluorescent or Roller F1 progeny, thus requiring screening of many progeny. Using Cas9 protein complexed with Alt-R CRISPR crRNA:tracrRNA to form a ribonucleoprotein (RNP), the group has obtained editing efficiencies ranging from 25–77% of red/Roller F1 progeny carrying (small) insertions, which are often homozygous. Larger insertions have been somewhat less efficient and more variable than the smaller indels, but still occur at frequencies high enough to make positive selection (e.g., for hygromycin resistance) unnecessary.

For the RNP approach to be successful, it is essential to have a good source of S. pyogenes Cas9 protein, ideally stored at high concentration. The Dernburg Lab has been using Cas9 protein produced on site by their core facility, and provided at ~40 µM, or ~6 µg/µL. S. pyogenes Cas9-NLS protein can also be obtained from IDT at 10 µg/µL in 50% glycerol [61 µM].

Templates for homology directed repair

The researchers are currently using single-stranded donor DNA to insert both small and large tags, with flanking homologous ends ranging from ~35–500 bases. While their data is still preliminary, in several direct comparisons, the scientists observed much higher insertion frequencies with these long ssDNA templates than a corresponding dsDNA (plasmid or PCR product). Using Cas9 RNPs + ssDNA templates, the scientists also see far fewer aberrant events (e.g., complex indels) than with plasmid delivery of Cas9.

Insertion templates up to 200 bases are obtained as Ultramer® Oligonucleotides (IDT). For longer insertion templates, the lab uses gBlocks® Gene Fragments (synthetic dsDNA; IDT) or constructs a plasmid template, and amplifies these by asymmetric PCR (primer extension). Successful reactions produce a single major band on an agarose gel, which the lab then purifies [QIAquick® (Qiagen) or Zymo Clean & Concentrator™ (Zymo Research) column following protocol for ssDNA] and quantifies by A260. Gel separation and band purification can be particularly beneficial for more complex amplicons. Other methods for synthesizing single-stranded templates from dsDNAs should also be suitable.

For simple gene disruptions, one can inject the Cas9 + crRNA:trRNA RNP without a repair template and screen for indels. However, it is useful to include a repair template that will insert a small sequence, e.g., with a rare restriction site, which can greatly facilitate screening and (later) genotyping for strain construction or maintenance.

Q5® polymerase (New England Biolabs), the proofreading PCR enzyme primarily used in the lab’s experiments, does not always produce an asymmetric PCR product. In these cases, the scientists use Taq polymerase.

Screening for edited progeny

The researchers enrich for edited F1 progeny using 2 different methods based on prior publications. In the first, the scientists co-inject 2 plasmids carrying red fluorescent transgenes (pCFJ90 [Pmyo-2::mCherry] and pCFJ104 [Pmyo-3::mCherry]), and then pick and screen red fluorescent F1s. They also use the dpy-10 co-CRISPR strategy described by the Fire laboratory [2]. Both methods are quite effective. Dr Abby Dernburg, PI of the laboratory, explains, “The dpy-10 screening is a bit easier up front. Ironically, our mutation efficiencies using Cas9 protein with Alt-R oligos are so high that it can actually be hard to find many Rollers (dpy-10 heterozygotes) following dpy-10 co-CRISPR. Many F1 progeny from injected P0 animals are already homozygous for dpy-10 mutations, which means that you may have to cross this out. When edited F1 progeny are not homozygous, they often have indels at the second locus, indicating that cutting by Cas9 is extremely robust. When we do dpy-10 co-CRISPR with injected protein, we obtain ‘jackpot’ broods in which virtually all F1 produced during a time window after injection show a Dumpy or Roller phenotype, further indicating that a good injection often leads to extremely high editing efficiency.”

Dernburg Method

  1. Prepare injection mixture (assemble Cas9-crRNA:trRNA RNP following the IDT Alt-R® CRISPR RNP protocol, but using higher concentrations of both protein and RNA oligos):

    1. Anneal crRNA and trRNA oligos (200 µM each) in IDT Duplex Annealing Buffer: 5 min at 95˚C, followed by 5 min at room temperature (RT).

    2. For co-CRISPR, try a ratio of 1:12 [dpy-10:target gene] crRNAs.

      (The dpy-10 target sequence used by the Fire lab is GCUACCAUAGGCACCACGAG [2].)

    3. Mix 27 µM crRNA:trRNA duplex with 27 µM Cas9-NLS and incubate for 5 min at RT.

    4. Assemble the injection mix with the following final concentrations:

      • 17.5 µM Cas9 protein

      • 17.5 µM gRNA duplex(es)

      • 6 µM ssDNA repair template(s) or 0.16–2 µM dsDNA repair template(s), (higher concentration preferred)

      If using dpy-10 co-CRISPR, also include:

      • 0.5 µM ssDNA repair template for dpy-10

      If using red fluorescent transgene co-injection, also include:

      • 2.5 ng/µL pCFJ90 injection marker plasmid (toxic if expressed too highly)

      • 5 ng/µL pCFJ104 injection marker plasmid

  2. Inject 10–15 young adult hermaphrodites (or more) with sufficient injection mix to see visible ‘puffing’ of the gonad, and recover onto individual plates.

  3. After an appropriate number of days post-injection1, pick fluorescent F1 progeny (if fluorescent markers were co-injected) or Rollers2 from jackpot broods (for dpy-10 co-CRISPR) to individual plates. Allow them to produce self-progeny, then lyse and screen by PCR, typically using one primer within the insertion and one in a flanking sequence.

  4. 1 Injected P0 animals may be incubated at 25˚C to obtain transgenic F1s more quickly. In this case, pick red fluorescent F1s after 2 days. Rollers from dpy-10 co-CRISPR develop more slowly than WT animals, so it may be necessary to wait an additional day to pick them: ~3 days after injection at 25˚C or 4 days at 20˚C.

    2 Roller F1 are usually heterozygous for dpy-10 mutations. You can also pick Dumpys, though they are likely homozygous dpy-10 mutants, so you may need to cross this out later, based on experimental goals.

    NOTE: The major differences between this protocol and a method recently published by the Seydoux lab [3,4] are that this method includes a duplex annealing step with the oligos before adding the Cas9 protein, to form a RNP. IDT scientists have shown that CRISPR RNA and Cas9 protein delivered as an RNP facilitates more efficient genome editing compared to other approaches (see the data). This method uses an ~1:1 molar ratio of RNA oligos:Cas9 protein, rather than the 4:1 ratio used in the Paix et al. protocol [3,4]. The Dernburg lab also now uses ssDNA templates for all insertions/mutations.

Obtain a detailed, step-by-step user method. For specific questions, please contact Dr Dernburg at afdernburg@berkeley.edu.

References

  1. Richardson CD, Ray GJ, et al. (2016) Enhancing homology-directed genome editing by catalytically active and inactive CRISPR-Cas9 using asymmetric donor DNA. Nature Biotechnol, 34(3):339–344.

  2. Arribere JA, Bell RT, et al. (2014) Efficient marker-free recovery of custom genetic modifications with CRISPR/Cas9 in Caenorhabditis elegans. Genetics, 198(3):837–846.

  3. Paix A, Folkmann A, et al. (2015) High efficiency, homology-directed genome editing in Caenorhabditis elegans using CRISPR-Cas9 ribonucleoprotein complexes. Genetics, 201(1):47–54.

  4. Paix A, Schmidt H, et al. (2016) Cas9-assisted recombineering in C. elegans: Genome editing using in vivo assembly of linear DNAs. Nucleic Acids Res, 44(15):e128.


Dernburg lab profile

Dernburg lab

Dernburg lab members. Dr Abby Dernburg is fourth from the right, and Dr Simone Koehler is second from the left.

The Dernburg laboratory uses C. elegans to study chromosome 3-dimensional structure and behavior during meiosis. Errors during this special division process that transmits genetic information from parent to progeny lead to aneuploidy and are a major cause of human birth defects such as Down syndrome. A fundamental goal of this research group is to understand how homologous chromosomes interact with each other during meiotic prophase to ensure faithful segregation.

Their use of CRISPR technology has enabled the lab to carry out detailed functional analysis by introducing mutations into meiotic proteins, something that was impossible in C. elegans until very recently. The lab has also engineered a large number of genes by inserting epitopes and fluorescent protein tags for localization and in vivo imaging. You can read more about the Dernburg Laboratory’s research at https://mcb.berkeley.edu/labs/dernburg/.

Product focus—genome editing tools

Alt-R® CRISPR Systems—all of the reagents needed for successful genome editing.

 

  • Achieve higher efficiency genome editing than other methods by using Alt‑R CRISPR RNAs, which are optimized, nuclease resistant, and individually quality controlled
  • Avoid toxicity or innate immune response activation by using Alt-R CRISPR ribonucleoproteins, instead of in vitro transcribed CRISPR nuclease mRNA and sgRNAs
  • Select from 2 CRISPR systems based on Cas9 or Cpf1 endonuclease for increased target site options
  • Extend the ease-of-use and performance of the Alt-R system with additional CRISPR reagents for enhanced RNP electroporation, fluorescent visualization, and genome editing detection.

Learn more at www.idtdna.com/CRISPR.



Ultramer® Oligonucleotides—single stranded DNA sequences up to 200 nt for applications such as gene synthesis, qPCR standards, and mutagenesis.


Learn more at www.idtdna.com/ultramer.



gBlocks® Gene Fragments—double-stranded, sequence-verified, DNA genomic blocks, 125–3000 bp in length, that can be shipped in 2–5 working days for affordable and easy gene construction or modification. These dsDNA fragments have been used in a wide range of applications including CRISPR-mediated genome editing, antibody research, codon optimization, mutagenesis, and aptamer expression. They can also be used for generating qPCR standards.


Learn more at www.idtdna.com/gblocks.

Additional resources

6 pieces of data that will change how you set up your CRISPR-Cas9 experiments—To improve the efficiency of CRISPR-Cas9 genome editing, IDT scientists evaluated several factors—Cas9 delivery, crRNA and tracrRNA length, which gRNA formats provide the most efficient on-target editing and elicit the least toxicity, the importance of protospacer size and site selection—that influence how we design and perform genome editing experiments. Review the data and results for 6 important factors that were addressed. These experimental findings resulted in a set of potent CRISPR tools that are now offered as the Alt-R™ CRISPR-Cas9 System.

CRISPR guide RNA format affects genome editing outcomes—Learn how use of different formats for the guide RNAs associated with CRISPR-Cas9 genome editing can lead to different editing outcomes. The optimized, short RNA oligos that make up the crRNA and tracrRNA components of the Alt-R® CRISPR-Cas9 System outperform other CRISPR guide RNA formats. Unlike DNA expression constructs, short RNA oligos also are unable to incorporate into the target genome for cleaner editing results.

Getting started with Alt-R® CRISPR-Cas9 genome editing—Webinar: Watch a recording of our webinar to learn about the components of the Alt-R CRISPR-Cas9 System, get information on designing Alt-R CRISPR crRNA oligos, and review the genome editing protocol from the user guide.

Alt-R® CRISPR-Cas9 System: Ribonucleoprotein delivery optimization for improved genome editing—Webinar: Hear about the advantages of using a Cas9:tracrRNA:crRNA ribonucleoprotein (RNP) complex in genome editing experiments. Learn why it is the most efficient driver for genome editing compared to alternative methods, such as expression plasmids or the use of sgRNAs. We also review RNP delivery methods using cationic lipids and electroporation, and provide tips for optimized transfection in your system.

Author: Ellen Prediger, PhD, is a senior scientific writer at IDT.

© 2016 Integrated DNA Technologies. All rights reserved. Trademarks contained herein are the property of Integrated DNA Technologies, Inc. or their respective owners. For specific trademark and licensing information, see www.idtdna.com/trademarks.


CRISPR-Cas9 Genome Editing

With Alt-R CRISPR-Cas9 System get the core components for improved on-target editing performance, while experiencing lower toxicity, and no innate cellular response.

Increase your editing efficiency ≫


Related Content

Product page:

Alt-R CRISPR-Cas9 System

Webinar:

New RNA tools for optimized CRISPR/Cas9 genome editing

Learn how research conducted at IDT led to the development of a potent new set of CRISPR-Cas9 genome editing tools.

Poster:

Quantitative Measurement of CRISPR/Cas9 Gene Editing at the Level of Genomic DNA for sgRNA Site Selection Algorithm Development

User guide:

Alt-R CRISPR-Cas9 System User Guide