Pipet Tips
Ideas to Streamline Your Research

Tips for Using BLAST to Locate PCR Primers

Need a quick way to find the location of primers within a gene or the expected size of the resultant PCR product? In this tip we show you how to get this information using BLAST.

NCBI’s BLAST is an incredibly powerful tool that efficiently queries the massive Genbank database. However, due to the heuristic nature of BLAST and removal of low complexity data, queries for short sequences like primers often return incomplete data. The following tips will improve these results:

  1. Concatenate the two primer sequences into one sequence separated by ~20 Ns and enter into BLAST sequence box.
    Example: AATGATCCGCGACGCTAATGAGGANNNNNNNNNNNNNNNNNNNNNNNGG
    TTTGCTCGTTGGCTTACTGCTT

    Note: both primers can be in the same orientation as BLAST will search both strands for matches.
  2. Before submitting, narrow the search by selecting the species, if known; otherwise, choose Nucleotide Collection (nr/nt). If you’re looking for RT-PCR primers, select the reference mRNA sequences (refseq_mRNA) database.
  3. Under “Program Selection”, select the “Somewhat similar sequences (blastn)” program.
  4. Under Algorithm parameters, decrease word size to 16, increase expect threshold to 1000, and turn off the low complexity filter.

In the example below, the results with a line connecting the two boxes indicate the two primers are in the same sequence (Figure 1A). Clicking on these results shows location within the sequence (between bases 1005 and 1766 of the Mre11 transcript in yeast), and indicate the expected PCR product should be 761 bp in length (Figure 1B).

A. Alignment Scores Distribution of 70 Blast Hits on the Query Sequence
B. Best Alignment Best Alignment
Figure 1. BLAST Results Show Primer Positioning (A) and PCR Fragment Size (B). (A) Only the best 3 alignments are shown (blue lines at the bottom). Selecting one of them provides the actual sequence alignment as shown in Panel B. Alignment of the 2 portions of sequence, showing 100% identity.

Now read: Steps for a Successful qPCR Experiment,
or browse the current issue of the DECODED newsletter.