Demystifying Ribosome Assembly with Adenylated Oligos

Ribosomal Assembly

Ribosomes assemble proteins—fundamental components of cells. A typical yeast cell contains over 200,000 ribosomes and makes about 2000 every minute. This requires an enormous amount of energy and trans-acting factors. Deregulation of steps in ribosome biogenesis is often associated with alterations in cell cycle, cell proliferation, and cell growth, and contributes to increased susceptibility to cancer. Dr Sander Granneman (Wellcome Trust Centre for Cell Biology,University Edinburgh) and his principle investigator, Dr David Tollervey, have developed a UV cross-linking and cloning assay (CRAC) to precisely map pre-ribosome protein-RNA interaction sites in yeast. Using this method he hopes to identify which proteins directly bind to rRNA to elucidate their mechanisms of ribosome synthesis and assembly and their relationship with cancer and cell division.

UV Cross-linking and Analysis of cDNAs (CRAC)

The CRAC procedure (Figure 1), inspired by the CLIP technique [1], has been adapted by Dr Granneman for application proteome-wide in combination with Illumina Solexa Next Generation sequencing. A description of the technique, published in 2009 [2], and the IDT modified oligonucleotides it requires, follows.

Model system

Yeast is used as the model system, since it is genetically easy to modify and can be grown in large quantities. Since the ribosomal assembly pathway is highly conserved between yeast and human, results in the yeast model system have implications for human health and cellular processes.

The Procedure

The researchers UV irradiate yeast cultures expressing the ribosomal assembly protein of interest. Bound proteins are crosslinked to the rRNA. Initially only ribosome assembly factors that harbor known RNA binding motifs were selected; however, the CRAC methodology was later also successfully applied to other proteins, including those that require energy to exert their function (like RNA helicases and GTPases). The target protein contains an engineered His6-TEV-ProtA2 tag for subsequent IgG immunoaffinity purification. The TEV-ProtA portion of the tag is removed by TEV protease digestion and the riboprotein complexes are further nickel affinity purified under highly denaturing conditions, to ensure that only direct interactions remain. The group treats the complexes with RNase, leaving short, bound RNA fragments. These fragments are immobilized on nickel agarose beads. Adenylated and modified 3’ and 5’ linkers (see below) are ligated onto the fragments, and free linkers are washed away. After proteinase K treatment, the sample is ready for RT-PCR amplification to create the libraries for Illumina Solexa high-throughput sequencing or cDNA cloning (Figure 1).
 CRAC Procedure for Mapping and Analysis of Protein Binding Sites
Figure 1. CRAC Procedure for Mapping and Analysis of Protein Binding Sites.

Adenylated linkers

The UV crosslinking step is inefficient and yields very little material. However, the use of special linkers— IDT adenylated oligos and other specially modified adapters (Figure 2)—allows the group to isolate very small quantities of crosslinked RNA for sequencing. “The IDT adenylated oligos and adapters have been essential for this technique—they are highly specific and increase the sensitivity of our application. We’ve ordered quite a few of them and they all worked great”, notes Dr Granneman.

3’ linker

A 3´ oligo linker, adenylated at the 5’ end, is ligated to the 3´end of the RNA using a mutated and truncated T4 DNA ligase that only ligates adenylated DNA oligos to 3´ RNA ends (Figure 2). DNA linkers are not only cheaper (than RNA), but, when used with the mutant ligase, also provide incredible specificity. This avoids circularization of the RNA substrates and other nonspecific or secondary reactions. “Because we have such low concentrations of RNA substrate, this step was imperative,” says Granneman. “I couldn’t get the CRAC technique to work efficiently without it”. The adenylated linker is also blocked at the 3’ end, preventing linker multimerization, which can be a big problem in these sequencing applications.

5’ linker

The 5’ linker is a DNA/RNA hybrid (Figure 2). IncludingDNA in the oligonucleotide provides more stability. Some commercial recombinant enzymes contain RNA exonuclease contaminants; adding DNA sequences to the 5’ end helps prevent degradation. The 5’ linker also includes an inverted ddT cap-like structure to protect against degradation and prevent inappropriate ligations.

The supplementary data in Granneman et al. (2009) [2] provides a detailed description of the CRAC technique, the linkers required, and a technique the lab has adopted for  using barcoded linkers for multiplexing samples.

5’ linker 5’-invddT-ACACrGrArCrGrCrUrCrUrUrCrCr-
GrArUrCrUrNrNrNrUrArArGrC-OH-3’
3’ linker 5’-AppAGATCGGAAGAGCGGTTCAG/ddC/-3’ 
Figure 2. Custom Synthesized Sequencing Oligonucleotides for Use in CRAC. Available from IDT.

Identifying the Role of Ribosomal Assembly Proteins

The CRAC technique is providing a comprehensive map of protein:RNA interactions in ribosome assembly intermediates. One important finding is that rRNA binding sites for ribosomal proteins overlap, possibly preventing ribosomal proteins from binding stably or prematurely [3]. Many of these factors also bind to highly conserved regions of the rRNA, suggesting they play an important role in assembling functional domains or the active site of the ribosome itself.

“The field has been kept from major advancements largely due to the lack of structural information on ribosomal assembly intermediates, which are very large and heterogeneous. Combining CRAC results with results from recent Cryo-EM and crystallography studies [4, 5] have allowed us to pinpoint where these proteins are binding and more accurately predict the function of ribosome assembly factors”, notes Granneman.

Many of these proteins are enzymatic factors that require ATP to function, such as RNA helicases and GTPases. The lab is now designing new assays to measure RNA structural changes (e.g., RNA unwinding assays). Granneman hopes these assays will determine whether the identified rRNA sequence is a substrate for RNA helicase and how these proteins remodel the ribosomal complex. In collaboration with Dr Granneman and Dr Tollervey’s lab, Markus Bohnsack and colleagues have already used CRAC to identify the first in vivo binding site for an RNA helicase [6]. Future assays will involve purifying ribosomal assembly intermediates, adding ATP, and measuring structural changes. When done in parallel with cryoelectron microscopy on these particles, Dr Granneman hopes to put together a clearer picture of the dynamics of ribosome assembly in yeast.
Sander Granneman

Researcher Profile

A biology student from Holland, Sander Granneman (right) completed his PhD (Radboud University Nijmegen) on work linking RNA:protein complexes to rheumatoid arthritis through their targeting by autoimmune antibodies. Postdoctoral work at Yale with Dr Susan Baserga introduced him to RNA helicases, and provided the ground work for his current research. He has since returned to Europe for a second postdoctoral position in the laboratory of Dr David Tollervey at the University of Edinburgh, Scotland. Dr Granneman just received a 5-year Wellcome Trust Research Career Development Fellowship at the Institute for Structural and Molecular Biology, University of Edinburgh, where he now works as a Principal Investigator.

"It’s been great working with IDT—they are not just providing an important product with these adenlyated oligos, but have also been very helpful in designing the oligos I needed. For me it’s had a huge impact.”
– Sander Granneman
References
1.  Ule J, Jensen KB, et al. (2003) CLIP Identifies Nova-Regulated RNA Networks in the Brain. Science, 302:1212–1215.
2.  Granneman S, Kudla G, et al. (2009)
Identification of protein binding sites on U3 snoRNA and pre-rRNA by UV cross-linking and high throughput analysis of cDNAs. Proc Nat Acad Sci, 106: 9613–9618.
3.  Granneman S, Petfalski E, et al. (2010) Cracking Pre-40S ribosome Structure by Systematic Analyses of RNA-Protein Cross-linking. EMBO J, 29:2026–2036.
4.  Ben-Shem A, Jenner L, et al. (2010) Crystal structure of the eukaryotic ribosome. Science, 330(6008): 1203-1209.
5.  Schafer T, Maco B, et al. (2006) Hrr25-dependent phosphorylation state regulates organization of the pre-40S subunit. Nature, 441(7093): 651-655.
6.  Bohnsack MT, Martin R, Granneman S, et al. (2009) Prp43 bound at different sites on the pre-rRNA performs distinct functions in ribosome synthesis. Molec Cell, 36:583–592.