Primers for 454 Sequencing System

Fusion Primers consist of a 20–25 bp target-specific sequence (3′ end) and a 19 bp fixed sequence (Primer A or Primer B on the 5′ end).

Amplicon sequencing projects use 454 Fusion Primers to incorporate specific identifying sequences into your gene-specific primers. This allows the process to proceed directly into emPCR for sequencing and is often associated with Ultra-Deep sequencing applications.

• The software enables an investigator to initiate the survey of one or more gene locus.
• 454 FusionPrimers are optimized across all functionality in the workflow, not just the initial PCR.
• Users can create sequencing primers for large surveys as well as specific focused projects.

GS FLX Titanium Fusion Primers have a 25 bp fixed sequence (Primer A or Primer B on the 5′ end) and optional Multiplex Identifier (MID) sequence. This design will allow:

• Longer amplicons to be sequenced
• An increase in the number of reads per run
• An improvement in read representation for bidirectional sequencing
• More simplified choices for reagent kits and protocols

Titanium Rapid Library MID Oligos are intended for shotgun sequencing; the MIDs are included in order to multiplex different samples on a single sequencing run.

GS FLX Titanium Rapid Library MID Adaptors Extended List

The GS FLX Titanium Rapid Library MID Adaptors Extended List includes a set of Adaptors that can be substituted for the Adaptors of the GS FLX Titanium Rapid Library Preparation Kit for the preparation of DNA libraries for sequencing on the Genome Sequencer FLX System. Tagging multiple libraries with different MIDs allows them to be amplified and sequenced together in a single region of the PicoTiterPlate device. For customers that need more MIDs than the twelve supplied by 454 in the GS FLX Titanium Rapid Library MID Adaptors Kit, this Extended List provides additional sequences that have been optimized for MID applications.

Each MID sequence contains at least 4 changes (insertion, deletion, or substitution) to make it unique from the other members of the Extended MID Set. This means that, for any of these MIDs, it is possible to either detect up to 2 errors and correct 1 error, or alternatively, detect 3 errors and correct none.

The Extended Set MIDs are sorted according to the number of reagent flows needed to sequence each, with a lower number indicating fewer flows. As a result, the lower numbered entries of the Extended Set MIDs are preferable to the higher numbered Adaptors because they can be sequenced using fewer reagent flows thereby maximizing the number of remaining flows for sequencing the library fragment. 

The Genome Sequence System is able to sequence single molecules within a mixture of molecules. Each amplicon molecule is sequenced individually which allows for rare variants to be identified and haplotype information to be assigned. This method relies on emulsion PCR (emPCR) with special Fusion Primers which attach specific 3′ and 5′ adaptors (sequence A and B) to each end of the fragments. The primers have a target-specific region and a fixed region which serves as a priming site during the clonal amplification and allows the fragment to bind to the DNA Capture Beads. In addition, the fixed sequences act as the primers site during the sequencing reaction.

Primer A: Left template-specific primer
Fusion Primer A: GCCTCCCTCGCGCCATCAGTCTGACGATCTCTGTCTTCTAACC

Primer B: Right template-specific primer
Fusion Primer B: GCCTTGCCAGCCCGCTCAGGCCTTGAACTACACGTGGCT

Through the use of unique Multiplex Identifier (MID) Adaptors for each individual library, the libraries can be amplified by emPCR and sequenced together in one multiplex reaction. Once the sequencing reads are complete, the data analysis software can deconvolute the data so that each individual library can be identified by its MID tag.

The GS FLX Titanium Rapid Library MID Adaptors can be substituted for the Adaptor of the GS FLX Titanium Rapid Library Preparation Kit during the creation of a library from a DNA sample (e.g., genomics DNA from an organism of interest). The library consists of a set of single-stranded template DNA fragments representing the entire span of the sample sequence. Each fragment is flanked by suitable amplification and sequencing DNA adaptors (MID adaptors in this case), then purified and quantitated.

MIDs become part of the sequence of each read in the library, such that they provide a recognizable sequence tag at the beginning of each read. When multiple libraries are prepared with different MIDs, they can be sequenced together, in a single region of the PTP device; the data analysis software then deconvolutes the data and assigns each read to the correct library. Multiplex sequencing can greatly improve the utilization of available wells on the PTP device during a sequencing run. This technique can be especially useful for sequencing many small samples in parallel, such as samples from viruses, BACs, plasmids, small bacterial genomes, disease-associated regions, etc.