|   | 
  

Primers for 454 Sequencing System Roche 

In an exclusive agreement with 454 Life Sciences, a Roche Company, IDT is able to provide researchers with 454 Fusion Primer design software and custom primers for the Genome Sequencer FLX System.

454 Fusion Primers are required for a number of 454 Sequencing applications. These applications include "ultra-deep", amplicon sequencing for detection of low-frequency mutations, and the comprehensive identification and quantification of common and rare sequences within a population. These studies are easily initiated with 454 Fusion Primer design software to target individual exons or all exons from one or more genes.

Roche recommends IDT’s HPLC-purified 454 Fusion Primers as the best way for a researchers to ensure they are getting the best data from their sequencing runs. The high purity level of HPLC-purified primers minimizes the risk of mis-priming events due to truncations and other errors that may compromise sequencing data quality or the number of viable reads that can be obtained from a single PicoTiterPlate run. As with all IDT oligos, identity is guaranteed with 100% Mass Spec QC.


Documentation and Support


Order Using IDT 454 GS FLX System Primer Design Tool

GS FLX Standard Fusion Primers

The Fusion Primer design tool will incorporate specific indentifying sequences into your gene-specific primers.

GS FLX Titanium Fusion Primers

Design and order GS FLX Titanium Fusion Primers which will allow for longer and improved sequencing runs. 


Order from 454 GS FLX System Extended MID Rapid Library Set

GS FLX Titanium Rapid Library Adaptors with Extended MID List

Access all available Molecular Identifier (MID) tags available. MIDs will allow identifying tags to be placed on multiple libraries so that they may be multiplexed for sequencing.


Heading

Fusion Primers consist of a 20–25 bp target-specific sequence (3′ end) and a 19 bp fixed sequence (Primer A or Primer B on the 5′ end).

Amplicon sequencing projects use 454 Fusion Primers to incorporate specific identifying sequences into your gene-specific primers. This allows the process to proceed directly into emPCR for sequencing and is often associated with Ultra-Deep sequencing applications.

  • The software enables an investigator to initiate the survey of one or more gene locus.
  • 454 FusionPrimers are optimized across all functionality in the workflow, not just the initial PCR.
  • Users can create sequencing primers for large surveys as well as specific focused projects.

GS FLX Standard Fusion Primers


Heading

GS FLX Titanium Fusion Primers have a 25 bp fixed sequence (Primer A or Primer B on the 5′ end) and optional Multiplex Identifier (MID) sequence. This design will allow:

  • Longer amplicons to be sequenced
  • An increase in the number of reads per run
  • An improvement in read representation for bidirectional sequencing
  • More simplified choices for reagent kits and protocols
Titanium Fusion Primers can also be used to sequence existing amplicon libraries that were created using the Standard Fusion Primers. Roche highly recommends transitioning amplicon library designs to the new format to achieve optimal performance.

GS FLX Titanium System Fusion Primers


Heading

Titanium Rapid Library MID Oligos are intended for shotgun sequencing; the MIDs are included in order to multiplex different samples on a single sequencing run.

GS FLX Titanium Rapid Library MID Adaptors Extended List

The GS FLX Titanium Rapid Library MID Adaptors Extended List includes a set of Adaptors that can be substituted for the Adaptors of the GS FLX Titanium Rapid Library Preparation Kit for the preparation of DNA libraries for sequencing on the Genome Sequencer FLX System. Tagging multiple libraries with different MIDs allows them to be amplified and sequenced together in a single region of the PicoTiterPlate device. For customers that need more MIDs than the twelve supplied by 454 in the GS FLX Titanium Rapid Library MID Adaptors Kit, this Extended List provides additional sequences that have been optimized for MID applications.

Each MID sequence contains at least 4 changes (insertion, deletion, or substitution) to make it unique from the other members of the Extended MID Set. This means that, for any of these MIDs, it is possible to either detect up to 2 errors and correct 1 error, or alternatively, detect 3 errors and correct none.

The Extended Set MIDs are sorted according to the number of reagent flows needed to sequence each, with a lower number indicating fewer flows. As a result, the lower numbered entries of the Extended Set MIDs are preferable to the higher numbered Adaptors because they can be sequenced using fewer reagent flows thereby maximizing the number of remaining flows for sequencing the library fragment. 



GS FLX Titanium Rapid Library MID Adaptor Oligos


Heading

  1. Generate single-stranded template DNA library
    • Short adaptors that are specific to the 3′ and 5′ ends are added to each fragment for the purification, amplification, and sequencing steps. The single-stranded DNA library is then immobilized on DNA Capture Beads and emulsified. The result in one bead per unique fragment.
  2. Amplify the library with emulsion PCR (emPCR)
    • Each unique fragment is amplified individually but simultaneously with the other fragments in the library. The result will be several million copies of each unique fragment.
  3. Sequence to generate data
    • The Genome Sequences FLX Instrument uses a flow of individual nucleotides in a fixed order to sequence the hundreds of thousands of wells that each contain one bead.
  4. Analyze data with bioinformatics tools

For more information on this process, please see the Roche information on How it Works


GS FLX System Workflow


Heading

The Genome Sequence System is able to sequence single molecules within a mixture of molecules. Each amplicon molecule is sequenced individually which allows for rare variants to be identified and haplotype information to be assigned. This method relies on emulsion PCR (emPCR) with special Fusion Primers which attach specific 3′ and 5′ adaptors (sequence A and B) to each end of the fragments. The primers have a target-specific region and a fixed region which serves as a priming site during the clonal amplification and allows the fragment to bind to the DNA Capture Beads. In addition, the fixed sequences act as the primers site during the sequencing reaction.

Primer A: Left template-specific primer
Fusion Primer A: GCCTCCCTCGCGCCATCAGTCTGACGATCTCTGTCTTCTAACC

Primer B: Right template-specific primer
Fusion Primer B: GCCTTGCCAGCCCGCTCAGGCCTTGAACTACACGTGGCT


Overview of Amplicon Sequencing


Heading

Through the use of unique Multiplex Identifier (MID) Adaptors for each individual library, the libraries can be amplified by emPCR and sequenced together in one multiplex reaction. Once the sequencing reads are complete, the data analysis software can deconvolute the data so that each individual library can be identified by its MID tag.


Overview of Multiplexing


Heading

The GS FLX Titanium Rapid Library MID Adaptors can be substituted for the Adaptor of the GS FLX Titanium Rapid Library Preparation Kit during the creation of a library from a DNA sample (e.g., genomics DNA from an organism of interest). The library consists of a set of single-stranded template DNA fragments representing the entire span of the sample sequence. Each fragment is flanked by suitable amplification and sequencing DNA adaptors (MID adaptors in this case), then purified and quantitated.

MIDs become part of the sequence of each read in the library, such that they provide a recognizable sequence tag at the beginning of each read. When multiple libraries are prepared with different MIDs, they can be sequenced together, in a single region of the PTP device; the data analysis software then deconvolutes the data and assigns each read to the correct library. Multiplex sequencing can greatly improve the utilization of available wells on the PTP device during a sequencing run. This technique can be especially useful for sequencing many small samples in parallel, such as samples from viruses, BACs, plasmids, small bacterial genomes, disease-associated regions, etc.


Application for GS FLX Titanium Rapid Library MID Adaptors