You will be logged off in  seconds due to inactivity. Click here to continue using this web page.

CRISPR-Cas9 gRNA entry

Loading Page...

# of Items:
(5' → 3')
# Bases:
GC: %  Tm: ºC  DeltaG: kcal/mole

The following items have errors:
,

Looking for controls?

To order, increase the # of items, then copy and paste the appropriate name and sequence from the following list into this ordering page:
Cpf1 positive control crRNAs
Item Name: Cpf1 Pos Ctrl crRNA, Human HPRT
Sequence: GGTTAAAGATGGTTAAATGAT
Item Name: Cpf1 Pos Ctrl crRNA, Mouse HPRT
Sequence: GGATGTTAAGAGTCCCTATCT
Item Name: Cpf1 Pos Ctrl crRNA, Rat HPRT
Sequence: ATGCTTAAGAGGTATTTGTTA
Cpf1 negative control crRNAs
Item Name: Cpf1 Neg Ctrl crRNA #1
Sequence: CGTTAATCGCGTATAATACGG
Item Name: Cpf1 Neg Ctrl crRNA #2
Sequence: CATATTGCGCGTATAGTCGCG
Item Name: Cpf1 Neg Ctrl crRNA #3
Sequence: GGCGCGTATAGTCGCGCGTAT
lockup_1
lockup_2
© 2018 Integrated DNA Technologies, Inc.