You will be logged off in   seconds due to inactivity. Click here to continue using this web page.

ReadyMadeTM Primers
10µg of > 95% pure primer as established by CE. Identity confirmed by Mass Spec.

Quantity Name Description Price
16S rRNA For AGAGTTTGATCCTGGCTCAG $10.00 USD
16S rRNA Rev ACGGCTACCTTGTTACGACTT $10.00 USD
3' RACE PCR GGCCACGCGTCGACTAGTAC $10.00 USD
Anchored Oligo dT (20) TTTTTTTTTTTTTTTTTTTV $10.00 USD
Anchored Oligo dT (22) TTTTTTTTTTTTTTTTTTTTVN $10.00 USD
BGH Reverse TAGAAGGCACAGTCGAGG $10.00 USD
Bluescript KS TCGAGGTCGACGGTATC $10.00 USD
Bluescript SK CGCTCTAGAACTAGTGGATC $10.00 USD
cDNA Cloning Primer GGCCACGCGTCGACTAGTACTTTTTTTTTTTTTTTTTV $10.00 USD
EGFP-C CATGGTCCTGCTGGAGTTCGTG $10.00 USD
EGFP-N CGTCGCCGTCCAGCTCGACCAG $10.00 USD
GAPDH For ACCACAGTCCATGCCATCAC $10.00 USD
GAPDH Rev TCCACCACCCTGTTGCTGTA $10.00 USD
M13 Forward (-20) GTAAAACGACGGCCAGT $10.00 USD
M13 Forward (-41) CGCCAGGGTTTTCCCAGTCACGAC $10.00 USD
M13 Reverse (-27) CAGGAAACAGCTATGAC $10.00 USD
M13 Reverse (-48) AGCGGATAACAATTTCACACAGG $10.00 USD
Neomycin For CTTGGGTGGAGAGGCTATTC $10.00 USD
Neomycin Rev AGGTGAGATGACAGGAGATC $10.00 USD
Oligo dT, (20) w/5' Phos /5Phos/TTTTTTTTTTTTTTTTTTTT $10.00 USD
Oligo dT, 15 mer TTTTTTTTTTTTTTT $10.00 USD
Oligo dT, 16 mer TTTTTTTTTTTTTTTT $10.00 USD
Oligo dT, 18 mer TTTTTTTTTTTTTTTTTT $10.00 USD
Oligo dT, 20 mer TTTTTTTTTTTTTTTTTTTT $10.00 USD
PCMV Forward CGCAAATGGGCGGTAGGCGTG $10.00 USD
pET 3’ CTAGTTATTGCTCAGCGG $10.00 USD
pET 5’ (T7) TAATACGACTCACTATAGG $10.00 USD
pGEX 3’ CCGGGAGCTGCATGTGTCAGAGG $10.00 USD
pGEX 5’ GGGCTGGCAAGCCACGTTTGGTG $10.00 USD
Random Hexamer NNN NNN $10.00 USD
Random Hexamer w/Biotin /5Biosg/NNN NNN $10.00 USD
SP6 Promoter TACGATTTAGGTGACACTATAG $10.00 USD
SP6 upstream ATTTAGGTGACACTATAG $10.00 USD
T3 Promoter AATTAACCCTCACTAAAGGG $10.00 USD
T7 Promoter TAATACGACTCACTATAGGG $10.00 USD
T7 Terminator GCTAGTTATTGCTCAGCGG $10.00 USD
 
-

-


Design and Analysis Tools
-

-


Related Products
-

-