gene_expression

Affinity Plus qPCR Probes

Increase SNP target specificity and use shorter sequences with these high TLNA probes

Use Affinity Plus qPCR Probes for SNP genotyping, transcript variant identification, and more sensitive target detection in challenging samples (FFPE tissue, biofluids). The Affinity Plus bases used in these qPCR probes include up to 6 locked nucleic acid (LNA) monomers (see the technology page, Locked nucleic acids (LNA), for more information). When incorporated into a probe, LNAs impart heightened structural stability, leading to increased hybridization melt temperature (Tm).

  • Improve mismatch discrimination compared to traditional qPCR probes
  • Benefit from this affordable approach to increasing assay hybridization specificity
  • Make flexible Tm adjustments more easily than possible with MGB probes

Ordering

Mini Affinity Plus qPCR Probes

Mini Affinity Plus qPCR Probes are ideal for screening small sample sets or performing just a few reactions when optimizing probe designs.

5' Reporter Dye(s)Quencher(s)Delivery Amount
0.5 nmol
FAMIowa Black FQ *$90.00 USD
HEXIowa Black FQ *$90.00 USD
YAKIowa Black FQ *$90.00 USD

Affinity Plus qPCR Probes

Affinity Plus qPCR Probes are offered with a wider selection of dyes and quenchers than Affinity Plus Mini qPCR Probes, and are best-suited for large-scale or high-throughput applications.

Loading...

Advantages of Affinity Plus qPCR Probes containing LNA modifications

Locked nucleic acid (LNA) bases, such as Affinity Plus monomers, can be incorporated into effective qPCR probes [1–4]. Because LNA bases significantly increase Tm, Affinity Plus qPCR Probes can be designed with shorter lengths than standard qPCR probes. Shorter probes have better quenching and a higher signal-to-noise ratio and are, therefore, more sensitive. More importantly, these LNA probes offer an improved ability to distinguish mutations or single nucleotide polymorphisms (SNPs) [1]. An Affinity Plus qPCR Probe can be designed with several LNA monomers resulting in a ΔTm of >15°C, which greatly increases accuracy of allele determination in real-time PCR or other methods that use differential hybridization to distinguish polymorphisms.

Affinity Plus qPCR Probes can be ordered either at a guaranteed yield of 0.5 nmol or at defined synthesis scales to suit your research needs.

Mini Affinity Plus qPCR Probes

  • Ideal for analyzing small sample sets or performing a few reactions when optimizing probe designs
  • Available with FAM, HEX™, or Yakima Yellow® (YAK) fluorescent dyes, and Iowa Black FQ Quencher
  • Guaranteed normalized yield of 0.5 nmol
  • Shipped in 4–6 business days

Affinity Plus qPCR Probes

  • Available with FAM, Cy® 3, Cy 5, TEX, TYE™, YAK, and HEX dyes
  • High synthesis scales (250 nmol and 1 µmol) for large-scale and high throughput requirements
  • Shipped in 4–6 business days

Design considerations

  • Depending on sequence context, each LNA base insertion into a DNA oligo will increase the Tm by 3–6°C. Multiple LNA additions can result in an Affinity Plus qPCR Probe with a ΔTm of >15°C.
  • The relative binding affinity (Tm) of Affinity Plus LNA bases are Affinity Plus:Affinity Plus > Affinity Plus:DNA > DNA:DNA. Therefore, it is important to examine the probe sequence for self-dimer and hairpin formation, and minimize designs that allow Affinity Plus:Affinity Plus pairing. Use the OligoAnalyzer Tool to check secondary structure predictions.
  • We recommend using up to 6 Affinity Plus LNA bases in an Affinity Plus qPCR Probe.
    • Affinity Plus LNA bases should be placed at the SNP site and on each of the adjacent bases. The SNP should be positioned in the center of the probe, if possible. Avoid placing Affinity Plus LNA bases on the first or last bases of the probe sequence.
    • Additional Affinity Plus LNA bases can be incorporated to adjust Tm as needed. We recommend placing no more than 4 Affinity Plus LNA bases sequentially.
    • Placement of the Affinity PlusLNA  bases is sequence dependent, and may require optimization to achieve optimal ∆Tm between match and mismatch.
  • Amplicon sizes up to 150 bp are recommended for standard qPCR. Shorter amplicons of 80–100 bp are typically recommended for digital PCR (dPCR) or for applications with samples containing shortened fragments (such as FFPE or small circulating DNA samples).

For additional assistance with designing Affinity Plus qPCR Probes, email applicationsupport@idtdna.com. Design fees may apply.

References

  1. Davialieva K, Kiprijanovska S, Plaseska-Karanfilska D. (2013) Fast, reliable and low cost user-developed protocol for detection, quantification and genotyping of hepatitis C virus. J Virol Methods, 196:104–112.
  2. Owczarzy R, You Y, et al. (2011) Stability and mismatch of locked nucleic acid–DNA duplexes. Biochemistry, 50(43):9352–9367.
  3. You Y, Moreira BG, et al. (2006) Design of LNA probes that improve mismatch discrimination. Nucl Acid Res 34(8):e60, doi:10.1093/nar/gkl175.
  4. Johnson MP, Haupt LM, Griffiths LR. (2004) Locked nucleic acid (LNA) single nucleotide polymorphism (SNP) genotype analysis and validation using real-time PCR. Nucleic Acids Res, 32(6):e55.




Enhanced sequence stability

Sequences containing Affinity Plus LNA nucleotides provide identical annealing properties as other manufacturers’ LNA sequences (Figure 1). The increased hybridization affinity and thus hybridization melting temperature (Tm) results in enhanced sequence stability both in vitro and in vivo.

Figure 1. Sequences containing Affinity Plus LNAs show identical annealing properties to LNA sequences from another manufacturer. The percentages of duplex melted base pairs are plotted as a function of temperature. The 15-mer sequence, GGTCCT+T+A+CTTGGTG, was synthesized with either Affinity Plus or other LNA modifications incorporated at the +T, +A, and +C sites. These oligos were mixed with the complementary DNA strand (1 μM each strand) in 1 M Na+ buffer (pH 7). Melt curves were performed as described in Owczarzy, et al., Biochemistry (2004), 43:3537–3554. The plots of duplex melted base pairs were averaged from at least 7 heating and cooling melting curves. Melting temperature was measured to be 67.7 ±0.3°C for the Affinity Plus LNA oligo and 67.9 ±0.3°C for the other LNA oligo. Free energy of duplex hybridization at 37°C was determined to be –18.1 ±0.9 kcal/mol for the Affinity Plus LNA oligo and –18.7 ±0.9 kcal/mol for the other LNA oligo. These results demonstrate the identical annealing properties of both sources of LNA sequences.

LNA probe advantage in qPCR assays

In comparison to unmodified probe sequences, the higher melting temperature of the LNA-containing Affinity Plus qPCR Probes provides better stability in qPCR assays with target regions of low GC content. The increased stability also makes possible the use of shorter probe designs, ideal when target regions are limited in size. Figure 2 demonstrates that Affinity Plus qPCR Probes provide the same amplification profile as PrimeTime qPCR LNA probes, with both showing more rapid target amplification vs. unmodified probes.

Figure 2. Affinity Plus qPCR Probes generate identical amplification data as PrimeTime LNA qPCR Probes. A custom PrimeTime qPCR Assay was designed to detect the M2-2 gene from the Human respiratory syncytial virus A strain. Using a gBlocks Gene Fragment as a target template, the performance of 2 LNA qPCR probes [17-base probes containing 7 LNA monomers at identical positions, manufactured as either Affinity Plus qPCR Probes or PrimeTime LNA qPCR Probes (Tm = 68.1°C)] were compared to the same DNA sequence without lock nucleic acid modifications (Tm = 49.9°C). Template and probe sequences are shown below in Table 1, (see Figure 2 sequences), with LNA positions denoted as +N. (A) Amplification curves using the 3 probes reveal that the Affinity Plus and PrimeTime LNA qPCR Probes yield identical results. (B) Threshold cycle (Cq) values comparing reactions with (gBlocks Gene Fragment) or without (NTC) template. Both probes containing LNA nucleotides were able to specifically amplify the template. NTC = no template control.

SNP analysis

The Figure 3 cluster plots from 4 genotyping assays demonstrate that LNA containing Affinity Plus qPCR Probes generate identical genotyping calls as PrimeTime LNA Probes. The probe sequences for both Affinity Plus and PrimeTime LNA probes used in the assays are shown below in Table 1 (see Figure 3 sequences).

Figure 3. LNA probes synthesized as Affinity Plus qPCR Probes generate identical genotyping calls as PrimeTime LNA Probes. Genotyping assays (n = 4) were run using 46 unique Coriell gDNA samples and the same probe sequences synthesized as either Affinity Plus qPCR Probes or PrimeTime LNA qPCR Probes. There were no differences in calls observed between Affinity Plus and PrimeTime qPCR LNA probes. All genotype calls matched previous results (data not shown). The sequences of the probes are listed in Table 1 (see Figure 3 sequences). All but rs1333049 are ADME (absorption, distribution, metabolism and excretion) assays.
Table 1. Probe, primer, and target sequences used to generate data presented in Figures 1–3.
NameSequence (+N = Affinity Plus or LNA nucleotide)
Figure 1 sequence
Affinity Plus sequenceGGTCCT+T+A+CTTGGTG
Other LNA sequenceGGTCCT+T+A+CTTGGTG
Figure 2 sequences
M2-2 forward primerGAGTCACTATGTATAATCAAAAAAACAC
M2-2 reverse primerTGATCCGGTGGGTATATATGG
LNA qPCR probes/56-FAM/TA+T+CAA+T+CA+AAA+CAA+CC/3IABkFQ/
Unmodified DNA/56-FAM/TATCCATCAAAACAACC/3IABkFQ/
M2-2 gBlocks Gene Fragment

TTGCGGAGGGAAGCTCATCAGTGGGGCCACGAGCTGAGTGCGTCCTGTCACTCCACTCCC ATGTCCCTTGGGAAGGTCTGAGACTAGGGTTAGAGTCACTATGTATAATCAAAAAAACACAC TATATATCAATCAAAACAACCAAAATAGCCATATATACCCACCGGATCAA

Figure 3 sequences
rs717620_C/56-FAM/AG+TCT+T+C+GTT+CCA/3IABkFQ/
rs717620_T/5YakYel/AGTCT+T+T+GTT+C+CAG/3IABkFQ/
rs1049434_A/56-FAM/CC+CTC+C+A+TCT+GTG/3IABkFQ/
rs1049434_T/5YakYel/C+CCTC+C+T+TCTGTGT/3IABkFQ/
rs1333049_G/56-FAM/A+C+AGT+T+G+AAAAGC/3IABkFQ/
rs1333049_C/5YakYel/AACAGT+T+C+AAA+A+GCA/3IABkFQ/
rs2273697_C/56-FAM/CT+CCA+A+C+GGT+GTAC/3IABkFQ/
rs2273697_T/5YakYel/TCTCCA+A+T+GGT+G+TAC/3IABkFQ/

Brochures and flyers

Frequently asked questions